Tomato sRNA S08777387
| Sequence | Length | annotation |
| AUAAAAUUGAACAAUUAGACGGAC | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3 |
0.4 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
10 |
0.74 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
35 |
14.64 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
9 |
9.2 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
32 |
8.05 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
106 |
30.04 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
145 |
37.1 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
154 |
74.18 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
92 |
76.43 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
144 |
81.65 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
233 |
71.89 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
398 |
104.49 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
5 |
1.5 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
6 |
1.82 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
4 |
1.21 |
|