TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S11184179

SequenceLengthannotation
AUGGCAGAGACAAUACCUGAAUA23miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1 0.22
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 11 0.81
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 18 13.87
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 39 29.59
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 6 4.27
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 23 16.94
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 25 15.61
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 27 17.2
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 23 15.16
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 36 22.01
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 20 11.97
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 487 475.17
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 479 279.63
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 667 654.28
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 223 157.71
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 170 185.06
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 246 235.04
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 116 335.09
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 4 2.79
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 14 18.68
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 15 6.27
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 31 7.8
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 9 2.55
S0712 Solanum lycopersicum MicroTom fruit , mature green 31 7.93
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 10 4.82
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 6 4.98
S0708 Solanum lycopersicum MicroTom flower, open 22 6.79
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 32 8.4
S0373 Solanum lycopersicum Heinz 1706 fruit 3 0.9
S0372 Solanum lycopersicum Heinz 1706 flower 2 0.61
S0371 Solanum lycopersicum Heinz 1706 leaf 1 0.3

S11184179 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc05g031610 1 23 + click here