Tomato sRNA S11184179
| Sequence | Length | annotation |
| AUGGCAGAGACAAUACCUGAAUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
11 |
0.81 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
18 |
13.87 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
39 |
29.59 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
6 |
4.27 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
23 |
16.94 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
25 |
15.61 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
27 |
17.2 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
23 |
15.16 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
36 |
22.01 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
20 |
11.97 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
487 |
475.17 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
479 |
279.63 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
667 |
654.28 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
223 |
157.71 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
170 |
185.06 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
246 |
235.04 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
116 |
335.09 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
4 |
2.79 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
14 |
18.68 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
15 |
6.27 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
31 |
7.8 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
9 |
2.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
31 |
7.93 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
10 |
4.82 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
6 |
4.98 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
22 |
6.79 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
32 |
8.4 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3 |
0.9 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
S11184179 mapped to the following genes
|