Tomato sRNA S11225252
| Sequence | Length | annotation |
| AUGGGUAGCACAAGGAUUAAUG | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
581 |
56.62 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
740 |
98.08 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
755 |
88.2 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1176 |
253.24 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1051 |
77.52 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
8 |
2.01 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1 |
0.28 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
6 |
1.54 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
9 |
4.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
10 |
5.67 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
10 |
3.09 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
3 |
0.79 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
152 |
45.5 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
248 |
75.06 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
218 |
65.69 |
|