Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
CGGAGAGUAGAAGGCAAGAG	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	4	0.3
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	224	93.67
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	112	114.53
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	644	162.1
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	162	45.91
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	202	51.68
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	178	85.74
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	95	78.92
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	312	176.9
S0708	Solanum lycopersicum	MicroTom	flower, open	62	19.13
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	113	29.67