TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S14954211

SequenceLengthannotation
CUUGGAACCACAGUUACCACC21miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 3 0.35
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 1 0.07
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 1 0.77
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 111 108.3
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 28 16.35
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 7 6.87
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 124 87.7
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 29 31.57
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 7 6.69
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 31 89.55
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 1 1.33

S14954211 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc12g011350 24 44 + click here