Tomato sRNA S14956632
| Sequence | Length | annotation |
| CUUGGACUGAAGGGAGCUCCC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
25 |
5.38 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
167 |
128.69 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
15 |
11.38 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
5 |
3.56 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
15 |
11.05 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
17 |
10.61 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
53 |
33.76 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
73 |
48.11 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
47 |
28.73 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
97 |
58.07 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
4 |
3.9 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
10 |
5.84 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
1 |
0.71 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
82 |
89.27 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
35 |
33.44 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
15 |
43.33 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
21 |
14.63 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
39 |
52.04 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4 |
2.27 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
93 |
24.42 |
|