Tomato sRNA S17569896
| Sequence | Length | annotation |
| GCUGACGGCGUUAGAUUGAUAUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
11 |
0.81 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
97 |
74.75 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
46 |
34.9 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
40 |
28.5 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
54 |
39.77 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
85 |
53.07 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
44 |
28.03 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
44 |
29 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
51 |
31.18 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
48 |
28.73 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
305 |
297.59 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
325 |
189.73 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
394 |
386.49 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
340 |
240.46 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
153 |
166.56 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
352 |
336.32 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
124 |
358.2 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
111 |
77.33 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
91 |
121.43 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
32 |
13.38 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
11 |
11.25 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
19 |
4.78 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
64 |
18.14 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
33 |
8.44 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
12 |
6.8 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
10 |
3.09 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
30 |
7.88 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
|