Tomato sRNA S17811956
| Sequence | Length | annotation |
| GGAGAAGCAGGGCACGUGCA | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
52 |
5.07 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
56 |
7.42 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
177 |
20.68 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2 |
0.15 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
435 |
181.9 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
70 |
71.58 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
716 |
180.22 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
51 |
14.45 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
53 |
13.56 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
10 |
4.82 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4 |
2.27 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
7 |
2.16 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
119 |
31.24 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
7 |
2.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
|