Tomato sRNA S18235633
| Sequence | Length | annotation |
| GGGAUUGUAGGCAGAGAGAUGGC | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2 |
0.15 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
143 |
110.2 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
26 |
19.72 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
94 |
66.97 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
111 |
81.75 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
141 |
88.04 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
52 |
33.13 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
73 |
48.11 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
109 |
66.64 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
137 |
82.01 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
11 |
10.73 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
9 |
5.25 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
28 |
19.8 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
45 |
48.99 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
9 |
8.6 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
11 |
31.78 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
65 |
45.28 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
98 |
130.77 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
15 |
6.27 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
14 |
14.32 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
33 |
8.31 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
32 |
9.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
24 |
6.14 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
68 |
32.76 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
65 |
54 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
174 |
98.66 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
27 |
8.33 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
49 |
12.86 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|