Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UAACUUCGUCUAGCUCGCCUUC	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	99	9.65
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	45	5.96
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	94	10.98
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1296	279.08
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	443	32.68
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	3	1.25
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	2	2.05
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	14	3.52
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	3	0.85
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	10	2.56
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	2	0.96
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	3	2.49
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	12	6.8
S0708	Solanum lycopersicum	MicroTom	flower, open	4	1.23
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	6	1.58
S0373	Solanum lycopersicum	Heinz 1706	fruit	500	149.66
S0372	Solanum lycopersicum	Heinz 1706	flower	189	57.2
S0371	Solanum lycopersicum	Heinz 1706	leaf	88	26.52