Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UACGCAGGAGAGAUGAUGCUG	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	13	1.27
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	67	8.88
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	53	6.19
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1932	142.5
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	10	2.52
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	1	0.28
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	58	14.84
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	5	2.41
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	1	0.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	19	10.77
S0708	Solanum lycopersicum	MicroTom	flower, open	370	114.16
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	390	102.39
S0373	Solanum lycopersicum	Heinz 1706	fruit	92	27.54
S0372	Solanum lycopersicum	Heinz 1706	flower	306	92.61
S0371	Solanum lycopersicum	Heinz 1706	leaf	1530	461.05