Tomato sRNA S22423036
| Sequence | Length | annotation |
| UCGCUUGGUGCAGGUCGGGACC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1503 |
146.46 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
454 |
60.18 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
110 |
12.85 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
7288 |
1569.42 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
4953 |
365.33 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
4 |
1.01 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
11 |
3.12 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2 |
0.51 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
7 |
3.37 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4 |
2.27 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
5 |
1.31 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
30 |
8.98 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
34 |
10.29 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
88 |
26.52 |
S22423036 mapped to the following genes
|