TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S22423036

SequenceLengthannotation
UCGCUUGGUGCAGGUCGGGACC22miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 1503 146.46
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 454 60.18
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 110 12.85
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 7288 1569.42
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 4953 365.33
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 1 0.42
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3 3.07
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 4 1.01
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 11 3.12
S0712 Solanum lycopersicum MicroTom fruit , mature green 2 0.51
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 7 3.37
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 7 5.82
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 4 2.27
S0708 Solanum lycopersicum MicroTom flower, open 4 1.23
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 5 1.31
S0373 Solanum lycopersicum Heinz 1706 fruit 30 8.98
S0372 Solanum lycopersicum Heinz 1706 flower 34 10.29
S0371 Solanum lycopersicum Heinz 1706 leaf 88 26.52

S22423036 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc08g005690 117 138 - click here