TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S22433645

SequenceLengthannotation
UCGGACCAGGCUUCAUUCCCC21miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 1487 144.9
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1133 150.17
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 6736 786.91
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 24621 5301.96
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 299402 22083.9
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 9751 7514.27
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 8157 6187.95
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 5443 3877.79
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 4035 2971.68
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 9071 5663.99
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 8544 5442.89
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 8474 5584.79
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 9195 5621.34
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 7914 4737.42
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 8412 8207.59
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 20286 11842.4
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 10455 10255.7
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 22248 15734.5
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 3342 3638.11
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 3208 3065.1
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 5662 16356
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 1501 1045.66
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 6822 9103.51
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 3607 1508.31
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 804 822.13
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 17364 4370.6
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 4239 1201.43
S0712 Solanum lycopersicum MicroTom fruit , mature green 20765 5312.52
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 4989 2403.19
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 1515 1258.57
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 1261 714.99
S0708 Solanum lycopersicum MicroTom flower, open 4163 1284.47
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 7152 1877.59
S0373 Solanum lycopersicum Heinz 1706 fruit 124829 37363.1
S0372 Solanum lycopersicum Heinz 1706 flower 67954 20565.7
S0371 Solanum lycopersicum Heinz 1706 leaf 139323 41983.8

S22433645 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc08g083150 113 133 + click here