Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UCGGACCAGGCUUCAUUCCUC	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1076	104.85
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	781	103.52
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1099	128.39
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3373	726.35
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	248892	18358.2
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	1078	450.78
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	167	170.77
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	3573	899.34
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	937	265.57
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	5151	1317.83
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	1721	829
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	549	456.08
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	1279	725.2
S0708	Solanum lycopersicum	MicroTom	flower, open	5625	1735.56
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	10779	2829.78
S0373	Solanum lycopersicum	Heinz 1706	fruit	5399	1616
S0372	Solanum lycopersicum	Heinz 1706	flower	107719	32600.3
S0371	Solanum lycopersicum	Heinz 1706	leaf	33682	10149.8