Tomato sRNA S22826029
| Sequence | Length | annotation |
|---|
| UCUUGGAUUUUAUCGGAGUUAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1820 |
134.24 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2 |
0.62 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
24 |
7.18 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
88 |
26.63 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
17 |
5.12 |
|
