Tomato sRNA S23094735
| Sequence | Length | annotation |
| UGACAGAAGAGAGUGAGCAC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
34 |
3.31 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
30 |
3.98 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
5 |
0.58 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
12803 |
944.35 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
4236 |
3264.32 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
4286 |
3251.39 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
4226 |
3010.76 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
4185 |
3082.16 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
4407 |
2751.76 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
2314 |
1474.12 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
4186 |
2758.78 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
5937 |
3629.57 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
4218 |
2524.95 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
14810 |
14450.1 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
2691 |
1570.93 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
2918 |
2862.37 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
1618 |
1144.3 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
18737 |
20397.1 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
9935 |
9492.46 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
40417 |
116754 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
5453 |
3798.78 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
6514 |
8692.51 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1622 |
678.26 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
216 |
220.87 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
5169 |
1301.06 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
174 |
49.32 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1409 |
360.48 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
232 |
111.75 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
54 |
44.86 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
33 |
18.71 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
195 |
60.17 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
750 |
196.9 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
601 |
179.89 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3008 |
910.35 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
8276 |
2493.9 |
|