Tomato sRNA S23224349
| Sequence | Length | annotation |
| UGAGAUGGUAAUAACGGUGAU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
17 |
1.66 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
88 |
11.66 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
161 |
18.81 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
7993 |
589.56 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
900 |
376.35 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
89 |
91.01 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1276 |
321.18 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
301 |
85.31 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
676 |
172.95 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
4 |
1.93 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
12 |
6.8 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
333 |
102.75 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
82 |
21.53 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
4145 |
1240.66 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1053 |
318.68 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
12447 |
3750.8 |
|