Tomato sRNA S23655829
| Sequence | Length | annotation |
| UGGAGAAGCAGGGCACGUGC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1624 |
158.25 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1164 |
154.28 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
235 |
27.45 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
27 |
5.81 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1 |
0.07 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
5168 |
2161.07 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
826 |
844.63 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
12410 |
3123.66 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
717 |
203.21 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
599 |
153.25 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
274 |
131.99 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
65 |
54 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
59 |
33.45 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
333 |
102.75 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1013 |
265.94 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
47 |
14.07 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
22 |
6.66 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|