Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGGAGAAGCAGGGCACGUGCA	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	51483	5016.76
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	35067	4647.97
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	7298	852.57
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	71	15.29
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	697	51.41
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	444685	185951
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	44200	45196.7
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	604124	152061
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	47019	13326.3
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	33081	8463.44
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	8081	3892.6
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	2506	2081.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	2230	1264.42
S0708	Solanum lycopersicum	MicroTom	flower, open	17529	5408.47
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	51775	13592.3
S0373	Solanum lycopersicum	Heinz 1706	fruit	10526	3150.58
S0372	Solanum lycopersicum	Heinz 1706	flower	5113	1547.41
S0371	Solanum lycopersicum	Heinz 1706	leaf	125	37.67