Tomato sRNA S25243999
| Sequence | Length | annotation |
| UUCUUGGCUAGAGUUGUAUUGC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3527 |
343.69 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1573 |
208.49 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
649 |
75.82 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
446 |
96.04 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
140 |
10.33 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
14 |
5.85 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
19 |
4.78 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
11 |
3.12 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
16 |
4.09 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
10 |
3.09 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
3 |
0.79 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
121 |
36.22 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
40 |
12.11 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
48 |
14.46 |
|