Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUCUUGGCUAGAGUUGUAUUGC	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	3527	343.69
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1573	208.49
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	649	75.82
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	446	96.04
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	140	10.33
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	14	5.85
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	19	4.78
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	11	3.12
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	16	4.09
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	1	0.48
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	3	2.49
S0708	Solanum lycopersicum	MicroTom	flower, open	10	3.09
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	3	0.79
S0373	Solanum lycopersicum	Heinz 1706	fruit	121	36.22
S0372	Solanum lycopersicum	Heinz 1706	flower	40	12.11
S0371	Solanum lycopersicum	Heinz 1706	leaf	48	14.46