Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUGGACUGAAGGGAGCUCCUU	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	24	2.34
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	19	2.52
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1142	133.41
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2394	515.53
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2	0.15
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	3	1.25
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	13	3.27
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	6	1.7
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	12	3.07
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	151	72.74
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	42	34.89
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	72	40.82
S0708	Solanum lycopersicum	MicroTom	flower, open	16	4.94
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	188	49.36
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0372	Solanum lycopersicum	Heinz 1706	flower	2	0.61
S0371	Solanum lycopersicum	Heinz 1706	leaf	3	0.9