Tomato sRNA S25628350
| Sequence | Length | annotation |
| UUGGCUGAGUGAGCAUCACGGAA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
20 |
1.48 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
4 |
1.13 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2 |
0.51 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
8 |
2.47 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
2 |
0.53 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
390 |
116.73 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
130 |
39.34 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
423 |
127.47 |
|