Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUUAGCAAGAGUUGUUUUACC	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	13187	1285.01
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	18820	2494.5
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	889	103.85
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	426	91.74
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2714	200.18
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	2	0.84
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	4	4.09
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	6	1.51
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	2	0.57
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	13	3.33
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	5	2.41
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	8	4.54
S0708	Solanum lycopersicum	MicroTom	flower, open	76	23.45
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	22	5.78
S0373	Solanum lycopersicum	Heinz 1706	fruit	308	92.19
S0372	Solanum lycopersicum	Heinz 1706	flower	315	95.33
S0371	Solanum lycopersicum	Heinz 1706	leaf	754	227.21