Tomato sRNA S26397462
| Sequence | Length | annotation |
| UUUGGAUUGAAGGGAGCUCUA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
6735 |
656.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3502 |
464.17 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
32314 |
3774.99 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
18011 |
3878.54 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1160 |
85.56 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
302 |
126.29 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
206 |
210.65 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1249 |
314.38 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
353 |
100.05 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
545 |
139.43 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3507 |
1689.32 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2634 |
2188.17 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4679 |
2653.01 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
781 |
240.97 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1988 |
521.9 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1013 |
303.21 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
467 |
141.33 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
974 |
293.51 |
|