Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUUGGAUUGAAGGGAGCUCUA	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	6735	656.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	3502	464.17
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	32314	3774.99
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	18011	3878.54
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1160	85.56
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	302	126.29
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	206	210.65
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	1249	314.38
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	353	100.05
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	545	139.43
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	3507	1689.32
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	2634	2188.17
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	4679	2653.01
S0708	Solanum lycopersicum	MicroTom	flower, open	781	240.97
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	1988	521.9
S0373	Solanum lycopersicum	Heinz 1706	fruit	1013	303.21
S0372	Solanum lycopersicum	Heinz 1706	flower	467	141.33
S0371	Solanum lycopersicum	Heinz 1706	leaf	974	293.51