Tomato sRNA S14956633
Sequence | Length | annotation |
CUUGGACUGAAGGGAGCUCCCU | 22 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 165 | 127.15 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 10 | 7.59 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 23 | 16.94 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 18 | 11.24 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 36 | 22.93 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 92 | 60.63 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 84 | 51.35 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 104 | 62.26 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 10 | 9.76 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 10 | 5.84 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 4 | 3.92 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 3 | 2.12 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 145 | 157.85 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 98 | 93.63 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 44 | 127.1 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 53 | 36.92 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 77 | 102.75 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 13 | 7.37 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 42 | 11.03 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
|